Fire, fuel and futures

There is a fascinating link between photosynthesis, fire, and an the development of our technological and political landscapes. I have been inspired by Iain Stewart's series on BBC "how the earth made us" and strongly recommend that you watch it whilst it still available. Photosynthesis, the conversion of carbon dioxide gas to sugars by plants using energy from light is probably one of the most important chemical reactions on Earth and has shaped the course of evolution on our planet. Between 2.5 and 1.5 billion years ago, the abundance of of algae and related organisms were such that oxygen started to accumulate in the earth's atmosphere, at first the reaction of oxygen with iron led to a global rusting event, which can still be seen in banded iron deposits in the world rocks. Secondly, when about 13% oxygen in the atmosphere was reached, the first fires could burn. It is astonishing to think that for the vast majority of our planet's history, fire did not exist.

The accumulation of oxygen was due to the proliferation of photosynthetic organisms, unfortunately, as anaerobes their waste product - oxygen - was toxic to them. The reaction with iron at first provided a buffer by effectively drawing down excess oxygen from the atmosphere. However, once a majority of reactive compounds had precipitated, free oxygen accumulated in the atmosphere, leading to probably the greatest extinction event, where over 97% of life on earth perished. Thus, the accumulation of oxygen in our atmosphere can be regarded as one of the greatest pollution events ever with catastrophic and planet changing consequences. However, aerobic respiration, using oxygen is essential for the energy demands of multicellular organisms, and their diversity flourished under these new conditions. Eventually leading to all of the wonderful flora and fauna that you and I are aware of and indeed part of.

Oxygen also enabled fire to burn and our ability to use ever more sophisticated sources of fuel has played an essential role in the development of civilisations. Initially our ancestors' ability to use wood fire greatly extended the range of food available, by modifying the chemistry of proteins and other components of our food. Humans may also have had used fire to create and manage grasslands from quite an early stage. Subsequently the ability to burn charcoal ushered in the bronze age, coal the steam age and industrial revolution and oil - well, you know we still dealing with oil. Fire is still central to our energy needs, although its appearance is often hidden within the generation of electricity or combustion engines. And the stuff that burns? Biological carbon atoms reacting with oxygen; both products of photosynthesis.

Much of our energy resources are derived from plant materials bringing us neatly to the photosynthetic reaction and the molecule I would like to introduce, Rubisco, the most abundant protein on earth. So how do plants take light and gas to make sugars and from there wood, charcoal...? Well, energy from light (photons) is converted by chlorophyll, a complex antenna-like pigment, to electrical energy you can think of the impact of a photon 'knocks out' an electron. The rest of the photosynthetic chain can be viewed as a sophisticated game of pass the parcel where an electron moves from molecule to molecule until trapped into the addition of H+ to NADP to give NADPH (the + on H+ signifies that this hydrogen has lost an electron, you can just think of NADP as 'a energy carrier' for now). These reactions are summarised in the image below. I would like to point out that chlorophyll is, quite bizarrely, closely biochemically related to haemoglobin, the red pigment in our blood. And that ATP synthase, the orange molecule on the right hand side of the diagram below, is a most wonderful and impressive rotary generator (I hope to talk about this and other time), one example where a wheel-like mechanism does exist in nature.


Thanks to wiki commons for the image

Rubisco didn't come in to this first stage of photosynthesis, but now it picks up the NADPH and it uses it in the fixation of carbon. By the way, did you notice, in the very first step of photosynthesis, the generation of oxygen (on the bottom left hand corner in the picture above)? No? Ah well, as such is the way with waste products. Rubisco is like a blobby doughnut (round with a small hole in the middle) made out of eight separate protein chains and is unusual in being a soluble enzyme that has only extremely recently been successfully re- folded in a test tube. This tells us that the structure of Rubisco needs to be extremely precise in order for it to work. (Most other soluble enzymes can be treated a lot more roughly and are generally easy to manipulate.)

Rubisco does fiddly task holding three components together; first the sugar (ribulose 1,5-bisphosphate), which can be thought of as a small string of five carbon atoms with a phosphate at each end, then the NADPH produced by the photosynthetic chain and finally carbon dioxide. The sugar is bent awkwardly so that some bonds are under strain, and the NADPH and carbon dioxide are brought into close proximity. These molecules react to create two 3 carbon sugars, each with one phosphate at an end (3-phosphoglycerate) . Et volia! The carbon from carbon dioxide is now trapped in a new smaller sugar molecule. The three carbon sugar can then be used for other things (e.g. to make wood or seeds) or recycled to create a new ribulose 1,5-bisphosphate and fix more carbon (this is known as the Calvin cycle). To be honest when I first learnt this I felt a bit cheated - so how did the cycle get started, where did the first five carbon sugars come from? Now, that's a topic for the origin of life.

Few people can be unaware of carbon dioxide in the current discussion of climate change, and Rubisco is the enzyme at the heart of the carbon cycle, busily adding and stitching new carbons on to old sugars. No matter how far up the food chain you think you are, all of the carbon atoms in your body will have at some point been fixed by Rubisco. Similarly, all of the carbon atoms released by the consumption of fuel to keep you warm and entertained will have passed through the same route. So photosynthesis has built up the immense reservoirs of coal, gas oil that the last century has been so extravagantly dependent upon. And is possible that photosynthesis will have a role to play in averting climate change. Rubisco works very slowly capturing only 2 to 3 molecules of carbon dioxide per second, as the reaction it catalyses is so fiddly . Worse, as Rubisco evolved when there was very little free oxygen in the atmosphere, it is inhibited by a high amounts of oxygen. Oxygen can squeeze into the slot that should be occupied by carbon dioxide, wasting the NADPH and five carbon sugar. Efforts are under way to re-engineer the enzyme for modern times. However I'm a little sceptical about how successful this will be, given the exquisite positioning of sugar, NAHPH and carbon dioxide that is needed. Rubisco is so sensitive that it is biased against naturally occurring radioactive isotopes of carbon (14C). This bias gives us the ability to carbon-date biological materials but does not bode well for our ability to re-engineer something so highly conserved in nearly all photosynthetic organisms over several billion years! Guess we've been playing with fire...

Henrietta Lacks -The first immortal?

Several book reviews this week have covered "The immortal life of Henrietta lacks " such as this one in the New York Times. I was astonished to learn the origin of probably the most famous human cell line, HeLa, through these reviews Even I, a plant scientist, have heard of them and regularly, enviously, read papers based on their research. HeLa stands for Henrietta Lacks, the unfortunate black woman from whom these cancerous cells were taken. Henrietta died in 1951 and her race was an integral part of the circumstances of her death and the immortality of the her cells. As I have not yet read the book I cannot comment on Henrietta's life, but I can describe the impact that her cells have on me.

Cell culture, that is the growth of individual cells in a nutrient broth, are an invaluable research tool. As the cells divide and grow continuously they are known as "immortal". Of course individual cells cannot cover the complexity of an organism with many different cell types and tissues (eyes muscles skin etc.) But as their growth conditions can be tightly controled to suit experiments, for example by adding drugs the all hormones to the growth media, they provide material for testing that cannot be done on the entire organisms. Furthermore, cell cultures have done more than any other technique to replace experiments on animals. Some types of cells do not grow well and only survive for a few weeks but HeLa cells have now survived for decades. This is perhaps an alarming measure of the malignancy of Henrietta's cancer. By the way, plant cells can also be grown in cell culture and a few can survive as long.

HeLa cells were one of the first products of what are now multinational pharmaceutical companies and have been used for research beyond that of human cancer. I first became aware of a HeLa cells through work on signaling pathways (i.e. receptor proteins), in particular those experiments using special forms of amino acids to determine changes that occur after receptor proteins have been elicited (triggered). It is really astounding to consider how far medical research has changed from the 1950s when the cancer cells were taken from Henrietta. Doubtless she would be astounded, and perhaps horrified, to learn of the fate of her cells. But I hope that she would also be amazed at the progress. It is shameful that the debt medical research goes to her, and by extension her family, is as yet unpaid.

The special forms of amino acids, I mentioned above, are made extra heavy at the atomic level through incorporation of stable isotopes (naturally occurring heavy forms of atoms i.e. C13 rather than C12 and N15 rather than N14). I am amazed that we can manipulate atoms and molecules at this level and delighted that one can simply order these custom made molecules from a pharmaceutical company: I feel future-shocked. So, to set up a cutting edge experiment on human cells one can simply order or borrow a HeLa cell line and custom amino acids and make light and have the forms of the cells. One can then treat or not two batches of the cells and go and look for differences. Could Henrietta be a real-life Cold Lazarus?

And as for the effect that HeLa cell research has had on me, well it has been truly inspirational. Plant science lags behind mammalian research on the finer details of signaling pathways, and I would love to obtain the same a level of detail that has been achieved for the egf pathway using HeLa cells. So far I had written two grants to try and achieve this and will shortly be writing my third. So results from human cell line research has played a crucial role in steering the course of my own career.

Seething coalition

Like you and me, cells live in a complex world. Even the simplest bacterium does not exist in isolation but needs to know what is happening outside. Is there food out there? A mate? A threat? Any cell - from a skin cell to an amoeba - also needs to have a sense of identity. It needs to recognise what is part of 'it' and what is not. As humans, we gain self-identity and perspective on the rest of the world through family, friends, facebook and trips to a therapist - oh - and by having a brain and memory. But how can a little cell recognise and respond to stuff? Even nestled within your body, individual cells make a lot of their own decisions. I hate to tell you this, but you're not much more than a coalition of cells. Don't imagine that your brain - much less you - actually tells them what to do. Sorry. See I knew you'd need a therapist.

One way that cells can detect what is happening outside is to hang receptors, or triggers, through their membrane (a thin, fluid fatty layer that defines the cell). Each receptor can detect a specific substance (or class thereof) and initiate a signal cascade when the substance is detected (by touching or binding to the receptor) and then the cell responds. Or so the textbooks say. But this disingenuous simplification plods over some absolutely fascinating questions; when the alarm is triggered, how is the signal transmitted and how does the cell (no brain remember) figure out how to respond, and is really everything - every possible thing that could happen to a cell - meticulously planned and each little signal pathway waiting like a row of dominoes? Of course I can't address all those questions here and will focus on a very early stage in signal perception; receptor dynamics at the membrane. There is so much stuff going on outside, why is a cell not overwhelmed with information? If a receptor is like an alarm light - how do you change the bulb (obscure Red Dwarf reference) or shut the thing off?




a stupefying textbook image of receptors and some elicitors (triggers).



To really appreciate receptors it's best to be clear exactly what a protein is. Previously I've drawn the analogy between a gene (DNA) and a simple computer program that does a task such as 'making protein A'. The DNA program is first copied to messenger RNA and then processed into a protein by ribosomes. The ribosome reads the letters of the genetic code in triplets, such as AUG-CAA-GAC. The code is non-overlapping and discrete, this means that there is a clear 'start' point and a correct reading frame. If the example above were to lose the first letter then UGC-AAG-AC would have quite a different meaning. A four letter code read in sets of three gives 64 possible codons. Twenty amino acids are commonly used to make proteins, so we have more than enough codons for each. Thus some amino acids have several possible codons whilst others have only one.
Image from Wiki commons
But what is an amino acid? These molecules all share the same core structure shown above but have 20 different side chains (R above). The side chains give different properties: Some amino acids are acidic and I think of them as 'tangy (citric acid, vinegar - these are of course not amino acids merely familiar acids), or basic (soapy), hydrophobic (water-hating or oily) or hydrophilic (water loving, wet) or small or large. So the coding part of a gene (the messenger RNA) is read to make new chain of amino acids. Proteins range in size from around 30 amino acids up to huge great mamas of 1,000 amino acids or more. Peptides are the also chains of amino acids but are smaller generally less than 30 amino acids. The distinction is somewhat fuzzy and context-dependent.
For a brief diversion, I have squandered a little time and some great computational resources to demonstrate the genetic code and the structure of a peptide. The DNA sequence 'gcgaacgatcgcgaatggtaa' encodes the peptide ANDREW (using single letters to represent amino acids) or Ala-Asn-Asp-Arg-Glu-Trp (if you prefer 3 letters for your amino acids). This peptide has the molecular formula: C33H47N11O12 and a molecular mass of 789.7928. Below are some representations of ANDREW. The image on the right is a 'wireframe' model, showing bonds between the atoms as bars, the grey balls carbon atoms, red oxygen, and blue nitrogen and white hydrogen. In the middle is the same model as 'spacefill' showing the relative sizes of the atoms and the overall 'shape' of the peptide. Finally there is a disappointingly simple ribbon representation that makes the underlying structure more obvious; here you can see that the hydrophobic W is predicted to coil around, giving this short peptide a twisted structure.

OK so lecture over - receptors are proteins that, in these examples, hang through a membrane hoping to bind to a trigger substance. They come in all shapes and sizes and generally (but not always) have three main parts; the external (signal receiver), the bit that crosses the membrane (with more hydrophobic amino acids) and the internal part (aka alarm bell). Some are quite beautiful - to my eyes at least - and below is one of my favourite external domains (a leucine rich repeat, LRR) that through a series of beta sheets (in yellow) folds into a horse-shoe-like structure. I find it incredible that such precise and intricate 3D structures arise from a delicate balance of amino acid combinations (sometimes folding is assisted by other proteins). Some receptors thread back and forth through the membrane, whilsts others (like a typical LRR recpetor) do so just once.


Receptors play so many roles in the life of a cell that it is with great restraint I have picked only two examples; cell movement (motility) and cell defence against a bacterium. Quite a disturbing piece of biology is my first example: Primordial germ cell migration. Germ cells make gametes (eggs and sperm) and bizarrely can be regarded as immortal because divisions of these cells pass through the generations, whilst the rest of the cells in your body will die with you. Gametes are formed during embryo development and the cells which are destined to become germ cells - primordial germ cells, PGCs - migrate from all over the embryo to congregate in the appropriate place. I am equally fascinated and repulsed to learn that PGCs squeeze through the developing gut to reach the gonads. Ewww. I don't know why other cells develop in the correct location and PGCs do not. Anyway, to migrate correctly the misplaced PGCs must know where they are headed and they follow a signal. More tractable cells, which are already at the place where gonads will develop, secrete a chemical called SDF1. As I'm sure you've already guessed, PGCs detect SDF1 by using a receptor.

To interpret the signal correctly the cell uses a couple on neat little tricks. Firstly the PGC must develop polarity, that is one part of the cell must become 'forwards' and secondly the cell must accurately gauge where is signal is coming from. The first part seems quite easy. SDF1 receptors are distributed equally over the surface of the membrane (well according to Minina et al ) so the cell 'runs' towards the signal. Most times the cell will not be pointing directly at the source of the signal and when the signal intensity diminishes the cell tumbles for a while to re-orient itself. One can imagine a program something like 'if concentration SDF1 greater than amount x then run forward, else tumble.' Such running and tumbling is a classic model for cell migration for many cell types any you may well have encountered it during high school biology lessions.

of course this image has beeen (gratefully, but possibly illegally) borrowed from Minina et al.

But this program has a problem, when moving towards a signal of increasing intensity as more and more parts of the cell surface receptors will recieve a signal >x. So the response needs to be attenuated as signal strength increases - or alternatively, the part of the cell surface receiving the most intense signal must be recognised. PGCs pull activated SDF1 receptors into the cell, by engulfing them in a little sack of membrane - a vesicle - and then destroy them. PGCs are polarised during a run, with the leading edge of the cell a veritable frenzy of endocytosis (internalisation vesicles), but during a tumble they lose this structured edge and it re-forms as a new direction is selected. Minina et al. showed that if you interfere with internalisation (and destruction) of SDF1 receptors (by creating a mutant receptor protein) then the PCGs can still head in the right direction but overshoot their target. It is not hard to imagine how these overactive receptors are bad news for any developing gonads.
De-sensitisation of activated receptors by internalisation (endocytosis) and degradation seems to be a widespread mechanism used in regulating responses to neurotransmitters, growth factors and many other stimuli. But there is some emerging evidence that endocytosis can be used in the opposite manner - to enhance active signalling. Here I'll switch over to plants and their response to pathogens.
A popular plant for research is Thale or mustard cress (Arabidopsis thaliana) and one of the best studied plant receptors is FLS2, a LRR that recognises part of bacterial flagellin. Many bacteria use a whip-like structure (flagella, think 'tails') to move around. Flagella are very similar between many species of bacteria - because it is a complex machine and not easy to change without breaking it - and therefore makes a good target for plants (or indeed animals) to recognise as 'non-self'. The flagellum is made up of repeating units of protein and FLS2 binds to a conserved part of this protein. FLS2 usually occurs at low concentrations in the plant plasma membrane (that outer layer; ignoring for now the plant cell wall). Proteins in a membrane are quite mobile; zipping around busily looking out for stuff to interact with. This obviously makes sense as there are very many things a cell needs to be aware of there is a limited about of time and space to make and present receptors to. When FLS2 hits a bit of a bacterial flagellin several changes occur, other proteins (from within the cell and within the membrane) also bind to FLS2 to form an active signalling complex. FLS2 also becomes less mobile (maybe to aid recruitment of these other proteins) and is then internalised.
Niko Geldner and Silke Robatzek suggest that FLS2 could actively signal from these internalised vesicles (a similar thing is known to occur for some animal receptors) and this could enhance signalling. A plant cell is very much larger than a bacterium, so rather than the PGC swimming in a diffusion of signal, the first sign of possible bacterial infection is rather subtle. Rather than destroying the active signalling complex to avoid over-stimulation it could be a smart trick to use the internal vesicle to provide a more sustained signal. Generally the signal needs to reach the nucleus (so that new defence genes can be switched on) and there is no reason why a bacterium should attack a cell conveniently near the nucleus. Internal vesicles can move around a cell, perhaps increasing response time and maybe making more room on the outer membrane for a few more FLS2 receptors to confirm the finding of the first.
So there you have it - a couple of ways cells figure out where to move to or how they (start) to respond to events like bacterial attack. Today I can personally attest to the importance of dealing appropriately with an alarm signal. I have written this post is a state of some distress because a neighbouring building has had an alarm sounding for exactly 12 painfully continuous hours (so far). The irresponsible fools have not provided the police with contact information, therefore their alarm is utterly useless because short of breaking into the building to shut the damned thing off there is nothing useful we can do. It is likely that I will be writing more later tonight; I apologise in advance if I am less good-humoured that usual.

The Venus of Willendorf

How do we get from the information stored in DNA to us? From that now-famous linear sequence of Gs, Ts, Cs, and As to the living, breathing, molecular symphony of life? Well, I can't explain it (at least not all). But I can tell you about an amazing little machine that sits right on the cusp of that transformation and it is, quite probably, largely responsible for the way life has turned out. I'm talking about ribosomes and if you're not a biologist, then it's possible that you've not met one before, so please allow me to introduce you and may I also present the ribosome's more famous children; DNA and proteins. Ribosomes are, in my opinion the Goddesses of molecular biology, ancient, life-creating and humbling in their sophistication - and not dissimilar in shape to the lovely Venus.

Image from Wiki commons

Made famous by the human genome project and a nifty structure, DNA is probably a good place to start the tale, and wiki has a fine page about deoxyribonucleic acid, with some great images. But the gist for this story is that DNA consists of two opposing strands of nucleotides - or letters - and that A always pairs with T and C pairs with G. This means that if one strand reads AATTGCGA the opposing strand will read TTAACGCT. The strands have direction and this is important for their coding (by convention one strand is called 'sense' and is read left to right or 5'to 3'. The opposing strand is charmingly called anti-sense and runs 3' to 5'. The 3' 5' by the way, refers somewhat obliquely to the actual chemical structure at the end of the strands. This means that when one is given a random piece of DNA one can - with practice - tell which direction to read it. However, as with much of life, the sense or anti-sense requires context.

Image from this nice tutorial

In eukaryotes like us, DNA is stored in the nucleus of a cell, (number 2 in a previous post) but the message is actually utilised out there in the cytoplasm. So the part of the code we want to use - usually a gene - is first unwound and one strand is copied into RNA. Chemically RNA is much like DNA except for the addition of a little oxygen and hydrogen group: ribonucleic acid. Also RNA uses U rather than T, but otherwise the code still holds; C copies to G, T to A etc. Thus a mobile message is made which can be processed and exported from the nucleus. Copying a message before use is a smart idea, as those of us who have corrupted unique files know, and copying also allows for amplification. Ribosomes themselves are so highly abundant in a cell that the copying (transcription) of their genes makes prominent 'Christmas tree' structures of frenetic activity, indeed an entire substructure of the nucleus, the nucleolus, is dedicated to their processing and production.

The copied RNA message is processed before being exported from the nucleus, most eukaryotic genes contain internal sections (introns) that are removed before the message is read. Perhaps it will be useful to consider a gene as a section of DNA that encodes a specific function - as does a short program, say a Perl script, and the function can be edited a bit according to need, i.e. dropping a sub-routine. The nucleotide letters are the text, the coding regions of a gene are the functional lines of the program and the introns represent comments. So a gene can mean 'make a protein called PKR according to this sequence' or the same gene, with a bit of editing, can mean 'make protein PKRv2, which does not have this part here'. Genes also encode for ribosomes, even though ribosomes are not (entirely) made from protein: the main part of a ribosome is RNA. Like bricks RNA can do two - and more - things: structural (building a house) or carrying a message (a brick thrown through a window).

Compared to the staid DNA, RNA is a wayward genius, blithely rejecting a stable partnership with another strand and instead adopting a dazzling variety of 3-dimensional structures. This variety means that RNA can play several functional roles. RNA can be an information store - just like DNA - and many very successful viruses (e.g. smallpox) use RNA as their genetic repository. RNA can also function as an enzyme - breaking and making bonds - and this discovery fundamentally changed our view of the origin of life. Sidney Altman and Thomas R. Cech were awarded the Nobel prize in Chemistry (1989) for their discovery that the RNA transcripts of ribosome genes can process (or edit) themselves, this is called self-splicing.

The discovery that RNA could not only store information but could also 'do' things like self-splice was so staggering because until then these roles had been neatly divided between DNA (information storage) and proteins (the tools of the cell making structures and performing enzymatic tasks like digesting your lunch). But with this world-view how could life get started? We were in a chicken and egg situation - which came first and how did the roles become so divided? Discovering that the humble RNA could do both suddenly placed this molecule at the very foundation of all life on earth. Wow.

Image from Wiki commons

Above is an image of a small subunit of a ribosome, (a fully functional one consists of two such parts, small and large). The twisty tan part is RNA and the purple parts are proteins. As such the ribosome is an amazingly complex machine. In eukaryotes up to 80 protein components integrate with 4 strands of the RNA core structure. So, after processing, messenger RNA heads out of the nucleus into the cytoplasm where it will be read by ribosomes and the encoded protein will be synthesised. Once again - amazingly - it is the RNA that hogs all the essential functions, reading the genetic code, catalysing the synthesis of protein, carrying components of the new protein from other parts of the cell to the ribosome is done by RNA structures. Even proof-reading of the genetic code against the newly made protein is performed by the ribosome.

In a paper published this week Bokov and Steinberg describe a model for the evolution of ribosomes. The core part of ribosomes are mind-bogglingly ancient - 4 billion years old - and that really is the very dawn of life on this planet. Their work shows how modern ribosomes added parts and functions to an ancient core and that traces of this original - world altering - structure can still be discerned today. Imagine holding the Venus of Willendorf in your hand. This stone-age carving is about 26 thousand years old. The person who made her was a modern human just like us in every regard - except that the mountain of technology we now enjoy had not yet been created. Imagine carving that figure - it's highly skilled work - and the evident humanity in it grabs my heart. Well ribosomes are such statuettes revealing the common origins of all life and so sophsticated that we are only just begining to understand how they function.

At first I thought that the evolution of ribosomes initiated the end of an RNA-dominated world. After all ribosomes are genesis machines for proteins which dominate our cellular structures (OK as a protein scientist I might be slightly biased) but as new functions for RNA are discovered (and more Nobel prizes awarded) I suspect that we are still living in an RNA-world and just don't fully realise it yet. I'm sure that these other function of RNA will inspire future blogs but for now I will leave you with structure of a ribosome in your hands. Enjoy.

travelling salesmen

A conversation with a friend about PKR has prompted me to write a bit about one way by which your body processes information and solves problems to keep you healthy. Please bear in mind that I'm not a human biologist - or rather I'm a biologist who does not study humans - so this might be a bit rough on any specialists out there. Please call me on my mistakes.

Your immune system is a miracle of rare device and here's a bridge over any chasms in your memory. When a foreign agent (such as a virus, bacteria or fungus) enters your body, if you are lucky, it will encounter a dentritic cell (DC for short). DC are highly mobile cells which guard your skin, the lining of your nose, lungs and intestines and will engulf any invader. You can see two DCs in action on wiki, the one on the left somewhat pathetically drags a fungal conidia around while the one on the right enthusiastically gorges itself on four whole ones. Ha! The unfortunate condia will then be broken down - digested - and parts of some of its proteins will be used to inform the rest of your body about the attack. The DC will migrate to a lymph node and present these little snippets of protein (an antigen) to T-cells.

cute dog from here

OK, so the faithful DC has made it to the lymph node and hopefully presents its chewed-up bit of fungal conidia protein as an antigen on its surface. Your body has population of around 25 million different T-cells which can recognise various different antigens. The DC will sit relatively still in the lymph node (having changed shape en route) and the smaller T-cells will rush by. If the antigen 'matches' a receptor on the surface of a T-cell then the two will bind quite tightly and the T-cell will pause. These T-cells will become killers; once activated by having matched an antigen to their receptor, they will go off and kill other cells - your other cells - that are presenting the same antigen on their surfaces. You see, other cells in your body will very nobly advertise that they are infected by a fungus (or whatever) and the activated T-cell will assist their suicide and prevent you from being overrun (with fungus or whatever).

But there's a problem here; very low numbers of a specific antigen are presented to very very many T-cell receptors. How can your body be sure to test all possible T-cell/antigen combinations efficiently? Remember that time is essential - once a bug gets inside you it can reproduce every 20 minutes or so and you want to nip that exponential growth early. Joost Beltman et al didn't buy the standard explanation - that T-cells would 'run and tumble' to a set program, say run for 2 microns and then tumble twice to find a new direction and hence sample lots of antigens. Even though it looks very much like that in real fluorescent-labelled cells and here in Beltman's simulation.

ah the inimitable xkcd

Running and tumbling is quite a complex thing for a cell to do. Is there an internal clock? How does a cell know how many runs to a tumble will be best? Are there any mutants out there; people with T-cells which only run or tumble insistently? And such behaviour is not appropriate at all times - once out on the prowl looking for sick cells to kill, should a T-cell be quite so giddy? No is the short answer; Beltman convincingly shows that the physical structure of the lymph node makes for efficient sorting by forcing T-cells into little turbulent streams. I think that this is a really neat solution to the problem. Take a moment to enjoy the slightly nauseous viewpoint of a T-cell being turbulently sorted. So there's no need for a complex run/tumble program. It's also noteworthy that Beltman and co. used a nice combination of real-life observations, maths and computer simulation and then went back to do some more RL observations.

To some extent (and with hindsight) the problem was a bit of an artifact created by the methods everyone used to view T-cell dynamics in the lymph node. Because fluorescence detection can easily become saturated only a small portion of T-cells could be labelled for viewing, so only a few individuals in a crowd could be tracked. But running and tumbling is not such a bad idea...plenty of cells are famous for just that sort of thing and even have some fascinating receptor dynamics and I'll talk about them in a future post.

I just love the way that nature solves these problems, getting that turbulent flow just right is a feat of engineering and fluid dynamics. Then using physical structure to tackle an NP-complete problem, well you've gotta admire it.

Like Hubble, but on the inside.

Here I am trying to write a science blog that I hope will interest my friends without using the word 'huskily' taking you right up to the cutting edge of some current science - even if you don't have a scientific background. So if you agree to nod and smile at any strange words I use (they may become friends in time) I think it's only fair if I give you a bit of context. Where is all this wonderful biochemistry happening and why is it so damned exciting? Cells is my answer, cells and proteins. The Nobel committee thought so too, honouring these three chaps for development of green fluorescent protein (GFP). GFP has allowed us to see what goes on inside living cells in astonishing detail, moving us away from diagrams of dried-up dead things to photos and 3D maps in living organisms. I'd like to introduce you to one protein, tubulin, and use it to illustrate cell structure and the very clever imaging technology we use to visualise it

Let's kick off with a bit or revision on the eukaryotic cell, as you are living in several billion of them right now. The text book version looks pretty much like this image I've borrowed from wiki.

There's a membrane (7) enclosing various organelles (9,6), the nucleus (1,2) and several other numbers you can safely ignore for now. And there we have it; life laid bare. Speaking in a generic way, one of these babies is quite capable of living by itself as a single cell organism - yeast for example, or of course making up magnificent beasts such as you and I. But this is all pretty dry stuff and the tubulin I've promised isn't even on Wiki's diagram but looks a bit like number 13 -and forms part of the cytoskeleton.

The cytoskeleton, as its name implies, can be thought of as giving structure to the cell - a kind of fibrous mesh. But it's not a static scaffold, rather it is constantly moving and being rebuilt; responding to changes. How is does this is really remarkable. Textbooks tell us that the cytoskeleton is made up from three types of fiber, microfibres, intermediate filaments and microtubules. I'll even drop the intermediate filaments from the discussion lest it turn into a lecture and just talk about microfibers and microtubules. Don't say I'm not good to you. These 'fibers' are pretty simple, they are composed of repeating units of proteins; actin for microfibers and tubulin for microtubules. A bit like lego:

But even cooler than Nathan Sawaya (lego art work above) is that microtubles are self-organising. Get enough of the 'tubulin bricks' together, give them a shake (under the right conditions) and off they go, zipping up into hollow tubes. It's as if the man above could build himself.

Image shamelessly borrowed from this paper

Ok I fibbed a bit, there are actually two forms of tubulin (alpha and beta) and in a cell there are plenty of other proteins involved, but you get the idea. Microtubules are directional structures in that one end grows faster than the other and therefore they can move about - quite fast too - by growing. Occasionally, perhaps at the behest of other proteins, they suffer catastrophe and unpeel like a banana. As well as being self-organising, microtubules and the cytoskeleton can respond something that might threaten the cell, a poke with a very small stick for example. This paper shows how the cytoskeleton of a plant cell responds to such a threat - within minutes you have serious rearrangement of microfibers, microtubules and even the endoplasmic reticulum (the pink bit in the wiki cartoon, number 5) gets in the act. Their paper is open source so I hope they don't mind me stitching a couple of their images together for brevity. And open source authors rock - so thanks guys! BTW these are plant cells which are very different to animal cells. Still they are eukaryotes too and I will recklessly carry on...

The real threats are pathogens (fungi, bacteria and oomycetes) which often try to penetrate cells (without consent!) to feed and grow to the detriment of the plant. In this case the cytoskeleton seems to organise the defence to just to spot attacked - and very fast too. How can bundles of proteins 'know' when to realign themselves? I don't have an answer to that question; it's still work in progress. I would love to know. Remember that there's no central organising 'brain' in a cell; LegoMan just can't compete.

Here's another image of eukaryotic cells showing the cytoskeleton (green) with the nucleus (blue) and membrane (red).

Well, this looks nothing like the lighting fast revision I put you through, indeed not; actual cells are interesting and beautiful especially when viewed with the magic of GFP and confocal microscopy. Not convinced? Well have a look at more images. The green colour comes, of course, from GFP, a small protein derived from jellyfish. (The baby, however is inexplicable.) With a bit of work one can add GFP as a tag to a favourite protein, in the images above tubulin was tagged, when you shine a blue light at GFP if fluoresces green allowing you to see where your protein is - even in living cells. There are now several colours and variations on original GFP tags (a particularly clever group made brainbow where they created a staggering 90 colours out of three florescent tags to identify individual neurones in living mouse brains. Wonderful stuff but sometimes it's hard luck for the mouse).

As if this wasn't enough, pioneering researchers like Stefan Hell are making nanoscopy feasible. A long-standing dogma had been that light microscopy was fundamentally limited by the wavelength of light. To put that in perspective, tubulin is 8 nm (0.000000008 of a meter) and microtubules 25 nm wide, while the resolution of pretty much all light microscopes until very recently has been an oval of 200 nm by 400-700 nm. This means that if your tagged proteins are closer together than this limit they will look like one blob, not two. Don't get me wrong, confocal (light) microscopy is amazing; it has been simply revolutionary to be able to visualise proteins in living cells. But nanoscopy is jaw-dropping we are now able to visualise single molecules in living cells. There are several techniques being developed (STORM, PALM etc.) but basically they all flip the fluorescent tags on and off on a single molecule basis and thus get around the diffraction limit, achieving resolutions of less than 20 nm by 50-70 nm. I leave you with one last image from a fine open source paper as a taste of things to come. Oh it's actually even better than this, ironically I've ruined the resolution whilst 'borrowing' the image. These are microtubules viewed on the left with confocal microscopy and on the right with nanoscopy. We can now clearly see individual microtubule strands!

I am so excited by these developments because getting around the diffraction limit of light delights the geek in me and there is so much we don't know about how cells and proteins function to create life. We can recognise most of the parts now, but there's no one bit that holds the essence of how that cytoskeleton responds to a poke. It's not a tic-tok mechanism but an emergent property of a complex system filled with precision nanoscale machines. Your cells are infinitely wondrous and now we can see a whole new order of magnitude opening up before us. The next few years will be beautiful.

Pox foxed!

If you are not surprised by evolution sometimes then perhaps - as Bohr so famously said of quantum mechanics - you haven't really understood it. I must admit that I frequently take evolution and selection pressures for granted. So it was delight to feel a frisson of wonder when reading a paper by Elde et al .

When to make proteins - and which ones - is a critical decision for a cell, and one which must be constantly under revision as circumstances change. One protein, eIF2a, is a central regulator of protein synthesis. As eIF2a is an essential part of the machinery which synthesises proteins it makes a good 'checkpoint'. Of course the 'machinery' aka ribosomes, are vastly complex and amazing entities and there are plenty of other regulatory and checkpoint mechanisms - but for now we'll just look at eIF2a.

The activity of eIF2a is controlled is by phosphorylation; the reversible addition of a little phosphate group by a kinase (which is a protein too). So phosphorylation acts like a on/off switch. A kinase called PKR can add phosphate to eIF2a and halt protein synthesis. Here's what these two proteins look like in a cartoon format:

PKR is shown in green on the right hand side and eIF2a in blue on the left. Note the little point of contact between the two a helix sticking out of PKR and the barrel of sheets in eIF2a. The crucial phosphrylation, by the way, is on one of those two strands which cross over the barrel. This imlies that PKR must coil around eIF2alpha to reach there.

PKR helps to defend a cell from viral attack, it is activated by the double stranded RNA found in several types of virus, and then rushes off to phosphorylate eIF2a and shut down protein synthesis. This works brilliantly as a defence because many viruses are nothing more than a bit of genetic material (DNA or RNA) coated with protein. Well, it did work brilliantly until some canny viruses - the pox amongst them - evolved proteins which mimic eIF2a and shut down PKR by binding tightly to the defender. If PKR is out of action then the cell can no longer shut down protein synthesis and thus avoid being hijacked by the virus. The pox virus has such a mimic protin called K3L and, as you can see below, K3L looks quite like eIF2a. The virus protein has only got that little barrel and a bit of a neighboring helix but it is enough to do the job of binding to PKR.

Well Elde and co. figured that PKR has a problem; it must be able to recognise its correct target, eIF2a, but would like to avoid binding to pesky viral mimics such as K3L. The structure of eIF2a can't change easily because it has such an important role in a complex machine - initiating protein synthesis in the ribosome - and therefore must fit snugly like a jigsaw piece. In fact eIF2a is one of the most highly conserved proteins, for example, the amino acid sequence of eIF2a of yeast and humans are astonishingly alike. So the virus in wants to copy eIF2a to fool PKR. Such an interaction is often described as an arms race. Sometimes K3L binds to PKR and the virus 'wins' and smallpox rages across countries, wiping out everyone with PKR proteins that fail to spot the intruder. Many of the survivors will, by necessity, have a variant form of PKR which can discriminate between the correct eIF2 and the dangerous decoy. To survive in the population the virus has to re-adapt the mimic protein. In midst of a smallpox epidemic having the 'right' form of PKR is a big advantage and this is a fundamental bit of evolution, the virus is applying a selection pressure on PKR. It's adapt or die.

If we look over evolutionary time we should be able to figure out which parts of PKR are responsible for recognising the mimics. How can we do this? Well, all proteins change slowly over the generations due to little errors made when copying DNA. For many parts of a protein this change may not be very important; it can still do its job well enough. If the mutation hits an important part though, such as eIF2 binding to a ribosome, well then that unfortunate individual will die (or fail to reproduce; this is the same to evolution) and the mutation will be lost. The important part of the protein - critical amino acids - will remain more unchanged than one would expect by chance alone and such parts of the protein are said to be under 'positive selection pressure'. If an external agent - such as a virus - applies the pressure then, somewhat tactlessly, biologists call this 'purifying selection'.

To find out if such selection occurs and which parts of PKR might be important in the eIF2a vs. K3L story Elde looked at DNA sequences of PKR from 20 primate species which cover about 30 million years. (Don't worry it's very unlikely any primates were killed for this work, a small tissue sample would be more than enough. In fact the information is probably already sitting in genbank .) They found that amino acid residue which line the interface between PKR and eIF2a have been subject to intense episodes of positive selection. In other words PKR in our bodies today still bears the marks from devastating epidemics thousands - or hundreds of thousands - or years ago when ALL variant forms of PKR were wiped out, along with their unlucky host. I find it astonishing that a disease - a little virus - can shape our proteins, indeed shape our evolution. I got kind of dizzy thinking about waves of epidemics and so much death - and yet here we are with hundreds of thousands of proteins making up our bodies, all shaped by various forces, many carrying remains of past evolutionary battles but still we rattle along.